gsprimer
-
Download gsprimer.pl
This application is designed to work within EMBOSS.
Function
Searches primers specific to a group of multiple species.
Description
“gsprimer” makes species(group)-specific primers for PCR. The primers are designed to be specific to amplify target species sequences, but not amplify non-target species sequences. At first, user has to gather target and non-target species’ sequences. The command “seqret” helps user to obtain the sequences. All you have to do is to input the 2 file, target and non-target sequences’ files. Then gsprimer output the primers with specificity score.
The following is the process of this application. At first, “gsprimer” activates “emma” to make multiple alignments of target sequences. Then “cons” creates two types of consensus sequences: loose sequence for reference, and strict sequence for calculation of scores. The loose consensus sequence consists of the base that is the most frequent base in the alignment column. Low homology parts between target sequences are not selected as part of 3' end piece of primer. Next, the consensus sequences and non-target sequences are aligned. The alignment is compared in all columns. The specificity score of a target species (or a target group species) is calculated against non-target species as described on below.
The base closest to the 3' terminal is given the highest weight 8, the second closest 5, third closest 3, fourth closest 2 and fifth closest 1. Scores are calculated by comparing the 5 bases of "consensus (strict)" with the corresponding 5 bases of each of the other species, and the lowest score is granted to the potential primers. "G" and "C" in the consensus sequence have 1.5 times the weight. In the above primers, the specificity scores with horse, whale, human, swine and poultry are 16.5 (8+5 1.5+0+0+1), 16.5, 12, 18.5 and 11.5 respectively. As a result, the lowest score, 11.5, is given to this potential primer.
Interim files [target file name].aln is alignment file including two types of consensus sequences and non-target sequences. Option "-align" use this file.
Usage
Here is a sample session with gsprimer
% gsprimer
Searches primers for a group of multiple species.
Input target sequences: target.fasta
Input non-target sequences: non-target.fasta
output filename [result_target.txt]:
Go to the input fileｓ for this example
Go to the output file for this example
Command line arguments
Standard (Mandatory) qualifiers:
| [-target] | seqset | File containing a list of target sequences. |
| [-nontarget] | seqset | File containing a list non-target sequences. |
| [-outfile] | seqout | Output filename. |
Additional (Optional) qualifiers:
| -align | seqset |
Alignment file (made by “gsprimer”).
User can skip the process, if the user has already made the alignment file. |
| -tm | integer | Tm value of primers. |
| -zeronum | integer | Allowed # of score 0 species. If the score is 0 only in case of # species in non-target, the primer candidate is output. In this case, the score except the causal species is outputted in brackets. |
| -threshold | integer | Sets the threshold of the score. |
| -discord | string |
Allowed discordance of homology between target species.
“1” is the most loose, and “3” is the strictest. |
| -dimer | Boolean | Modify homo-dimer. |
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-target] (Parameter 1) |
Input filename: the file containing target species’ sequences. | Readable set of sequences | Required |
| [-nontarget] (Parameter 2) |
Input filename: the file containing non-target species’ sequences. | Readable set of sequences | Required |
| [-outfile] (Parameter 3) |
Output filename | Any string is accepted | ‹∗›.txt |
| Additional (Optional) qualifiers | Allowed values | Default | |
| -align | Alignment file (made by “gsprimer”). User can skip the process, if the user has already made the alignment file. | Aligned file created by gsprimer | Required |
| -tm | Tm value of primers. | Any numeric value | 55 |
| -zeronum | Allowed # of score 0 species. If the score is 0 only in case of # species in non-target, the primer candidate is output. In this case, the score except the causal species is outputted in brackets. | Any numeric value | 1 |
| -threshold | Sets the threshold of the score. | Any numeric value | 0 |
| -discord | Allowed discordance of homology between target species. “1” is the most loose, and “3” is the strictest. Primers which its X bases of 3' end piece are all in accord with each other between target species sequences, and which the number of divergent bases that exist from (X+1)th to 17th from 3' terminal is within 7, are output. Discordance "1":( X, Y) = (3, 7), "2":( X, Y) = (5, 4), "3":( X, Y) = (7, 1). | 1, 2, 3 | 2 |
| -dimer | Modify homo-dimer. | none | none |
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
Input file format
The input consists of sequences. The command “seqret” is useful to obtain these sequences. This example is for making ruminant-specific primers.
Input files for usage example
File1: target.fasta
>cattlecataggtttggtcccagccttcctgttaactcttaataaacttacacatgcaagcatctacaccccagtgagaatgccctctaggttattaaaactaagaggagctggcatcaagcacacaccctgtagctcacgacgccttgcttaaccacaccccacgggaaacagcagtgacaaaaattaagccataaacgaaagtttgactaagttatattaattagggttggtaaatctcgtgccagccaccgcggtcatacgattaacccaagctaacaggagtacggcgtaaaacgtgttaaagcaccataccaaatagggttaaattctaactaagctgtaaaaagccatgattaaaataaaaataaatgacgaaagtgaccctacaatagccgacgcactatagctaagacccaaactgggattagataccccactatgcttagccctaaacacagataattacataaacaaaattattcgccagagtactactagcaacagcttaaaactcaaaggacttggcggtgctttatatccttctagaggagcctgttctataatcgataaaccccgataaacctcaccaattcttgctaatacagtctatataccgccatcttcagcaaaccctaaaaaggaaaaaaagtaagcgtaattatgatacataaaaacgttaggtcaaggtgtaacctatgaaatgggaagaaatgggctacattctctacaccaagagaatcaagcacgaaagttattatgaaaccaataaccaaaggaggatttagcagtaaactaagaatagagtgcttagttgaattaggccatgaagcacgcacacaccgcccgtcaccctcctcaaatagattcagtgcatctaaccctatttaaacgcactagctacatgagaggagacaagtcgtaacaaggtaagcatactggaaagtgtgcttggataaat>sheeptataggtttggtcccagccttcctgttaactttcaatagacttatacatgcaagcatccacgccccggtgagtaacgcccttcgaatcacacaggactaaaaggagcaggtatcaagcacacactcttgtagctcacaacgccttgcttaaccacacccccacgggagacagcagtaacaaaaattaagccataaacgaaagtttgactaagtcatattgaccagggttggtaaatctcgtgccagccaccgcggtcatacgattgacccaagctaacaggagtacggcgtaaagcgtgttaaagcatcatactaaatagagttaaattttaattaaactgtaaaaagccataattataacaaaaataaatgacgaaagtaaccctacaatagctgatacaccatagctaagacccaaactgggattagataccccactatgcttagccctaaacacaaataattataaaaacaaaattattcgccagagtactaccgcaacagcccgaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctataatcgataaaccccgataaacctcaccaatccttgctaatacagtctatataccgccatcttcagcaaaccctaaaaaagggacaaaagtaagctcaataataacacataaagacgttaggtcaaggtgtaacctatggagtgggaagaaatgggctacattttctacccaagaaaatttaatacgaaagccattatgaaattaatagccaaaggaggatttagcagtaaactaagaatagagtgcttagttgaatcaggccatgaagcacgcacacaccgcccgtcaccctcctcaagtaaatatgatatacttaaacctatttacatatatcaaccacacgagaggagacaagtcgtaacaaggtaagcatactggaaagtgtgcttggataaac>deercacaggtttggtcccagccttcctattgacccttaatagacttacacatgcaagcatccacaccccagtgaaaatgccctccaagttaataagactaagaggagctggtatcaagcacacatccgtagctcacgacaccttgcatagccacacccccacgggagacagcagtgataaaaattaagccataaacgaaagtttgactaagccatattaatcagggttggtaaatttcgtgccagccgccgcggtcatacgattaacccaagttaataggcatacggcgtaaagcgtgttaaagcactataccgaataaagttaaattccaattaagctgtaaaaagccataattgcaacaaaaataaacaacgaaagtaactttacagctgccgaaacacgatagctaggacccaaactgggattagataccccactatgcctagccttaaacacaaatagttatgtaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctataatcgataaaccccgataaacctcaccattccttgctactacagtctatataccgccatcttcagcaaaccctaaaaaggtacaaaagtaagcacaatcataatacataaaaacgttaggtcaaggtgtaacctatggaacggaaagaaatgggctacattttctaatctaagaaaatccaacacgaaagttattatgaaactaataaccaaaggaggatttagcagtaaactaagaatagagtgcttagttgaattaggccatgaagcacgcacacaccgcccgtcaccctcctcaagtaggcacaatacactcaaacttatttacacgtattaatcctatgagaggagacaaggcgtaaaaaagtgggaatactggaaagtgtgcttggataaat>goatcataggtttggtcccagccttcctgttaactctcaacagacttacacatgcaagcatccacgccccggtgagtaacgccctccaaatcaataagactaagaggagcaggtatcaagcacacatctcgtagcttacaacgcctcgcttaaccacacccctacgggagacagcagtgacaaaaattaagccataaacgaaagtttgactaagccatgttgaccagggttggtaaatctcgtgccagccaccgcggtcatacgattaacccaagctaacaggaatacggcgtaaaacgtgttaaagcactacatcaaatagagttaaattctaattaaactgtaaaaagccataattacaacaaaaatagatgacgaaagtaaccctactgcagctgatacactatagctaagacccaaactgggattagataccccactatgcttagccctaaacacaaataattacagaaacaaaattattcgccagagtactaccggcaacagcccgaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctataatcgataaac
File2: non-target.fasta
>pigcacaggtttggtcctggcctttctattaattcttaataaaattacacatgcaagtatccgcgccccggtgagaatgccctccagatcttaaagatcaaaaggagcaggtatcaagcacacctataacggtagctcataacgccttgctcaaccacacccccacgggaaacagcagtgataaaaattaagccatgaacgaaagtttgactaagttatattaattagagttggtaaatctcgtgccagccaccgcggtcatacgattaacccaaattaatagatccacggcgtaaagagtgtttaagaaaaaaaatcacaatagagttaaattataactaagctgtaaaaagccctagttaaaataaaataacccacgaaagtgactctaataatcctgacacacgatagctaggacccaaactgggattagataccccactatgcctagccctaaacccaaatagttacataacaaaactattcgccagagtactactcgcaactgcctaaaactcaaaggacttggcggtgcttcacatccacctagaggagcctgttctataatcgataaaccccgatagaccttaccaacccttgccaattcagcctatataccgccatcttcagcaaaccctaaaaaggaacaatagtaagcacaatcatagcacataaaaacgttaggtcaaggtgtagcttatgggttggaaagaaatgggctacattttctacatgagtatatccaccacacgaaagtttttatgaaactaaaaacccaaggaggatttagcagtaaatcgagaatagagtgcttgattgaataaggccatgaagcacgcacacaccgcccgtcaccctcctcaagcatgtagtaataaaaataacctatattcaattacacaaccatgcaagaagagacaagtcgtaacaaggtaagcatactggaaagtgtgcttggattac>horsecataggcttggtcctagcctttttattagttattaatagaattacacatgcaagtatccgcaccccagtgagaatgccctctaaatcacgtctctacgattaaaaggagcaggtatcaagcacactagaaagtagctcataacaccttgctcagccacacccccacgggacacagcagtgataaaaattaagctatgaacgaaagttcgactaagtcatattaaataagggttggtaaatttcgtgccagccaccgcggtcatacgattaacccaaattaataaatctccggcgtaaagcgtgtcaaagactaataccaaaataaagttaaaacccagttaagccgtaaaaagctacaaccaaagtaaaatagactacgaaagtgactttaatacctctgactacacgatagctaagacccaaactgggattagataccccactatgcttagccctaaactaaaatagcttaccacaacaaagctattcgccagagtactactagcaacagcctaaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttccataatcgataaaccccgataaaccccaccatcccttgctaattcagcctatataccgccatcttcagcaaaccctaaacaaggtaccgaagtaagcacaaatatccaacataaaaacgttaggtcaaggtgtagcccatgggatggagagaaatgggctacattttctaccctaagaacaagaactttaacccggacgaaagtctccatgaaactggagactaaaggaggatttagcagtaaattaagaatagagagcttaattgaatcaggccatgaagcgcgcacacaccgcccgtcaccctccttaaatatcacaaatcataacataacataaaaccgtgacccaaacatatgaaaggagacaagtcgtaacaaggtaagtataccggaaggtgtacttggataac>chickenaaaagacttagtcctaacctttctattggtttttgctagacatatacatgcaagtatccgcatcccagtgaaaatgcccccaaacctttcttcccaagcaaaaggagcaggtatcaggcacactcagcagtagcccaagacgccttgcttaagccacacccccacgggtactcagcagtaattaaccttaagcaataagtgtaaacttgacttagccatagcaacccagggttggtaaatcttgtgccagccaccgcggtcatacaagaaacccaaatcaatagctacccggcgtaaagagtggccacatgttatctgcaccagctaagattaaaatgcaaccaagctgtcataagcctaagatccacctaaacccaacccaaatccatcttagcctcaacgattaattttaacccacgaaagctaggacccaaactgggattagataccccactatgcctagccctaaatctagatacctcccatcacacatgtatccgcctgagaactacgagcacaaacgcttaaaactctaaggacttggcggtgccccaaacccacctagaggagcctgttctataatcgataatccacgattcacccaaccaccccttgccagcacagcctacataccgccgtcgccagcccacctctaatgaaagaacaacagtgagctcaatagcccctcgctaataagacaggtcaaggtatagcctatggggtgggagaaatgggctacattttctaacatagaacaaacgaaaaaggatgtgaaacccgcccttagaaggaggatttagcagtaaagtgagatcataccccctaagctcactttaagacggctctgaggcacgtacataccgcccgtcaccctcttcacaagccatcaacatcaataaatatatacttcccctcccggctaaagacgaggcaagtcgtaacaaggtaagtgtaccggaaggtgcacttagactac>tunacaaaggcttggtcctgactttactgtcaactctagctaaacttacacatgcaagtatccgcgaccctgtgagaatgccccacagttttccgcccgaaaacaaggagctggtatcaggcacacccaacgaaagcccatgacgccttgcttagccacaccctcaagggaactcagcagtgataaaccttaagctataagtgaaaacttgacttagttaaaggtaagaggccggtaaaactcgtgccagccaccgcggttatacgagaggcccaagttgacagacaccggcgtaaagcgtggttaaggtacacgaaaactaaagccgaacaccttcagggcagttatacgcatccgaaggcacgaagccccaccacgaaagtggctttataaaccctgactccacgaaagctatgacacaaactgggattagataccccactatgcctagccgtaaacattgatagaattttacaccctctatccgcctgggtactacgagcattagcttgaaacccaaaggacttggcggtactttagatccccctagaggagcctgttctataaccgatgacccccgttcaacctcaccctcccttgtttctcccgcctatataccgccgtcgtcagcttaccctgtgaaggtctaatagtaagcaaaattggcaccgcccagaacgtcaggtcgaggtgtagcgcatgagaggggaagaaatgggctacattcgctaacatagcgaatacgaacgatgcactgaaaacgttcatctgaaggaggatttagcagtaagtggaaaatagagtgttccactgaaatcggctctgaagtgcgtacacaccgcccgtcactctccccaagcttaccaatttatatatctaaaacgctttaactgcgaaggggaggcaagtcgtaacatggtaagtgtaccggaaggtgcacttggaaaaat
Output file format
The output contains primer candidates. The potential primers shown are those of ruminant-specific primers. Scores, Tm values, approximate positions, and sequences of potential forward and reverse primers are listed. Sequences of complementary strand are shown in brackets.
Output files for usage example
File: result_target.txt
| Forward primer | ||
| score:12 | Tm:54.33 | pos:55 ATAGACTTACACATGCAAGC |
| score: 7 | Tm:55.45 | pos:56 GACTTACACATGCAAGCA |
| score: 4 | Tm:56.06 | pos:57 GACTTACACATGCAAGCAT |
| score: 8 | Tm:53.16 | pos:127 CTGGTATCAAGCACACA |
| score: 5 | Tm:58.21 | pos:311 CGGCGTAAAACGTGTTA |
| score:12 | Tm:53.32 | pos:315 CGTAAAACGTGTTAAAGC |
| score: 7 | Tm:56.45 | pos:316 CGTAAAACGTGTTAAAGCA |
| score: 7 | Tm:55.80 | pos:364 AATTAAGCTGTAAAAAGCCA |
| score: 5 | Tm:54.77 | pos:365 ATTAAGCTGTAAAAAGCCAT |
| score:12 | Tm:54.73 | pos:409 AATGACGAAAGTAACCCTAC |
| score: 5 | Tm:54.45 | pos:479 TATGCTTAGCCCTAAACAC |
| score: 8 | Tm:58.18 | pos:562 ACTTGGCGGTGCTTTAT |
| score: 5 | Tm:57.26 | pos:563 CTTGGCGGTGCTTTATA |
| Reverse primer | ||
| score: 4 | Tm:58.69 | pos:12 CCCAGCCTTCCTGTTAA (TTAACAGGAAGGCTGGG) |
| score: 7 | Tm:55.44 | pos:13 CCAGCCTTCCTGTTAAC (GTTAACAGGAAGGCTGG) |
| score:12 | Tm:54.67 | pos:14 CAGCCTTCCTGTTAACTC (GAGTTAACAGGAAGGCTG) |
| score: 4 | Tm:61.69 | pos:52 AGCATCCACACCCCAGT (ACTGGGGTGTGGATGCT) |
| score: 7 | Tm:64.02 | pos:53 GCATCCACACCCCAGTG (CACTGGGGTGTGGATGC) |
| score: 7 | Tm:55.48 | pos:99 ACTAAGAGGAGCTGGTATCA (TGATACCAGCTCCTCTTAGT) |
| score: 6 | Tm:54.28 | pos:201 AAACGAAAGTTTGACTAAGTC (GACTTAGTCAAACTTTCGTTT) |
| score: 5 | Tm:57.60 | pos:292 TACGGCGTAAAACGTGT (ACACGTTTTACGCCGTA) |
| score: 6 | Tm:55.12 | pos:492 AACAAAATTATTCGCCAG (CTGGCGAATAATTTTGTT) |
| score: 5 | Tm:55.60 | pos:565 CTTCTAGAGGAGCCTGTTC (GAACAGGCTCCTCTAGAAG) |
| score: 8 | Tm:55.60 | pos:566 TTCTAGAGGAGCCTGTTCT (AGAACAGGCTCCTCTAGAA) |
Notes
None.
References
Shinoda N, Kusama T, Yoshida T, Sugiura T, Kadowaki K, Onodera T, and Sugiura K. 2008. Developing PCR primers using a new computer program for detection of multiple animal derived materials in feed. J. Food Prot.Nov;71(11):
Warnings
None.
Diagnostic Error Messages
None.
Exit status
It always exits with status 0.
Known bugs
None.
See also
| Program name | Description |
|---|---|
| seqret | Reads and writes (returns) sequences |
| emma | Multiple alignment program - interface to ClustalW program |
| cons | Creates a consensus from multiple alignments |
Author(s)
Naoki Shinoda (naoki_shinoda c nm.famic.go.jp)
Food and Agricultural Materials Inspection Center, Saitama, JAPAN
History
Target users
This program is intended to be used by everyone and everything.
Comments
None
